Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IdnR in Xanthobacter autotrophicus Py2

Properties
Regulator type: Transcription factor
TF locus tag: Xaut_2434
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Regulog: IdnR - Rhizobiales
Statistics of regulated genes:
- Genes 9
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -81
Score: 5.7
Sequence: TCATGATATCGGTAACATGA
Locus tag: Xaut_2436
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
Locus tag: Xaut_2435
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: Xaut_2434
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Locus tag: Xaut_2433
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
idnD
L-idonate 5-dehydrogenase (EC 1.1.1.264)
SSF54909
Dimeric alpha-beta barrel
idnR
Predicted transcriptional regulator of L-idonate utilization, LacI family
gnd
6-phosphogluconate dehydrogenase EC=1.1.1.44

Position: -83
Score: 5.7
Sequence: TCATGTTACCGATATCATGA
Locus tag: Xaut_2437
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: Xaut_2438
Name: Atu4687
Funciton: putative ABC transporter, substrate-binding component
Locus tag: Xaut_2439
Name: Atu4688
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Xaut_2440
Name: Atu4689
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Xaut_2441
Name: Atu4690
Funciton: putative ABC transporter, ATPase protein
idnO
Gluconate 5-dehydrogenase (EC 1.1.1.69)
Atu4687
putative ABC transporter, substrate-binding component
Atu4688
putative ABC transporter, membrane spanning protein
Atu4689
putative ABC transporter, membrane spanning protein
Atu4690
putative ABC transporter, ATPase protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD