Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IdnR in Rhizobium sp. NGR234

Properties
Regulator type: Transcription factor
TF locus tag: NGR_b22310, NGR_b22380
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Regulog: IdnR - Rhizobiales
Statistics of regulated genes:
- Genes 15
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -21
Score: 6.7
Sequence: TTATGTTATCGATAACATTC
Locus tag: NGR_b22260
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Locus tag: NGR_b22250
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
COG1063
Threonine dehydrogenase and related Zn-dependent dehydrogenases
idnD
L-idonate 5-dehydrogenase (EC 1.1.1.264)

Position: -217
Score: 6.5
Sequence: ATTTGTTATCGATAACATCT
Locus tag: NGR_b22370
Name: Atu4687
Funciton: putative ABC transporter, substrate-binding component
Locus tag: NGR_b22360
Name: Atu4688
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: NGR_b22350
Name: Atu4689
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: NGR_b22340
Name: Atu4690
Funciton: putative ABC transporter, ATPase protein
Atu4687
putative ABC transporter, substrate-binding component
Atu4688
putative ABC transporter, membrane spanning protein
Atu4689
putative ABC transporter, membrane spanning protein
Atu4690
putative ABC transporter, ATPase protein

Position: -88
Score: 4.8
Sequence: GAAGGTTATCGTTAACTTAG
Position: -67
Score: 6.5
Sequence: AGATGTTATCGATAACAAAT
Locus tag: NGR_b22380
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
idnR
Predicted transcriptional regulator of L-idonate utilization, LacI family

Position: -54
Score: 6.5
Sequence: TCATGTTATCGATAACATAA
Locus tag: NGR_b22410
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: NGR_b22400
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: NGR_b22390
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Sugar ABC transporter, ATP-binding protein
Sugar ABC transporter, inner membrane protein
Sugar ABC transporter, substrate-binding protein

Position: -48
Score: 6.7
Sequence: GAATGTTATCGATAACATAA
Locus tag: NGR_b22270
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: NGR_b22280
Name: idnK
Funciton: Gluconokinase (EC 2.7.1.12)
Locus tag: NGR_b22290
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
Locus tag: NGR_b22300
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: NGR_b22310
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
idnO
Gluconate 5-dehydrogenase (EC 1.1.1.69)
idnK
Gluconokinase (EC 2.7.1.12)
gnd
6-phosphogluconate dehydrogenase EC=1.1.1.44
SSF54909
Dimeric alpha-beta barrel
idnR
Predicted transcriptional regulator of L-idonate utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD