Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IdnR in Rhizobium etli CFN 42

Properties
Regulator type: Transcription factor
TF locus tag: RHE_PC00141
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Regulog: IdnR - Rhizobiales
Statistics of regulated genes:
- Genes 10
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -132
Score: 4.9
Sequence: TAAAGTTATCGCTATCATCG
Position: -37
Score: 6.1
Sequence: GGATGATATCGATAACAAAT
Locus tag: RHE_PC00140
Name: gnl
Funciton: Gluconolactonase (EC 3.1.1.17)
gnl
Gluconolactonase (EC 3.1.1.17)

Position: -98
Score: 6.8
Sequence: ATATGTTATCGATAACATAA
Locus tag: RHE_PC00143
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Locus tag: RHE_PC00142
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
COG1063
Threonine dehydrogenase and related Zn-dependent dehydrogenases
idnD
L-idonate 5-dehydrogenase (EC 1.1.1.264)

Position: -57
Score: 6.8
Sequence: GAATGTTATCGATAACATAT
Locus tag: RHE_PC00147
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: RHE_PC00148
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RHE_PC00149
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Sugar ABC transporter, ATP-binding protein
Sugar ABC transporter, inner membrane protein
Sugar ABC transporter, substrate-binding protein

Position: -105
Score: 6.8
Sequence: TTATGTTATCGATAACATAT
Locus tag: RHE_PC00144
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: RHE_PC00145
Name: idnK
Funciton: Gluconokinase (EC 2.7.1.12)
Locus tag: RHE_PC00146
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
idnO
Gluconate 5-dehydrogenase (EC 1.1.1.69)
idnK
Gluconokinase (EC 2.7.1.12)
gnd
6-phosphogluconate dehydrogenase EC=1.1.1.44

Position: -226
Score: 6.1
Sequence: ATTTGTTATCGATATCATCC
Position: -131
Score: 4.9
Sequence: CGATGATAGCGATAACTTTA
Locus tag: RHE_PC00141
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
idnR
Predicted transcriptional regulator of L-idonate utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD