Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IdnR in Bradyrhizobium sp. BTAi1

Properties
Regulator type: Transcription factor
TF locus tag: BBta_0778
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Regulog: IdnR - Rhizobiales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -114
Score: 5.7
Sequence: GATTGTTATCGATATCACTG
Locus tag: BBta_0778
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
idnR
Predicted transcriptional regulator of L-idonate utilization, LacI family

Position: -58
Score: 6
Sequence: TCCTGTTATCGATAACATAG
Locus tag: BBta_0777
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
idnO
Gluconate 5-dehydrogenase (EC 1.1.1.69)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD