Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IdnR in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type: Transcription factor
TF locus tag: Atu4685
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Regulog: IdnR - Rhizobiales
Statistics of regulated genes:
- Genes 10
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -177
Score: 6.4
Sequence: ATATGTTACCGATAACATTC
Locus tag: Atu4087
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
idnD
L-idonate 5-dehydrogenase (EC 1.1.1.264)

Position: -245
Score: 5.7
Sequence: CAATGATACCGATAACATGC
Position: -83
Score: 6.4
Sequence: AAATGTTATCGAGAACATTT
Locus tag: Atu4687
Name: Atu4687
Funciton: putative ABC transporter, substrate-binding component
Locus tag: Atu4688
Name: Atu4688
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Atu4689
Name: Atu4689
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Atu4690
Name: Atu4690
Funciton: putative ABC transporter, ATPase protein
Locus tag: Atu4691
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Atu4687
putative ABC transporter, substrate-binding component
Atu4688
putative ABC transporter, membrane spanning protein
Atu4689
putative ABC transporter, membrane spanning protein
Atu4690
putative ABC transporter, ATPase protein
COG1063
Threonine dehydrogenase and related Zn-dependent dehydrogenases

Position: -58
Score: 6.4
Sequence: GAATGTTATCGGTAACATAT
Locus tag: Atu4086
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: Atu4085
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
idnO
Gluconate 5-dehydrogenase (EC 1.1.1.69)
gnd
6-phosphogluconate dehydrogenase EC=1.1.1.44

Position: -232
Score: 6.4
Sequence: AAATGTTCTCGATAACATTT
Position: -70
Score: 5.7
Sequence: GCATGTTATCGGTATCATTG
Locus tag: Atu4686
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: Atu4685
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
SSF54909
Dimeric alpha-beta barrel
idnR
Predicted transcriptional regulator of L-idonate utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD