Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GabR in Corynebacterium aurimucosum ATCC 700975

Properties
Regulator type: Transcription factor
TF locus tag: cauri_0644, cauri_0645
Regulator family: [Other]
Regulation mode:
Biological process: Gamma-aminobutyrate utilization
Effector:
Regulog: GabR - Corynebacteriaceae
Statistics of regulated genes:
- Genes 9
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -138
Score: 5.5
Sequence: AATGGTGAGAAATTGTCCACAAT
Position: -44
Score: 5.2
Sequence: TGGGGATAGAAATTCTGCACGAT
Locus tag: cauri_0644
Name: gabR
Funciton: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family
gabR
Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family

Position: -96
Score: 5.4
Sequence: TAGGTGCAAAATTTATACACCCT
Locus tag: cauri_0646
Name: gabT2
Funciton: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
Locus tag: cauri_0647
Name: gabP
Funciton: Predicted amino acids permease
gabT2
Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
gabP
Predicted amino acids permease

Position: -207
Score: 5.2
Sequence: ATCGTGCAGAATTTCTATCCCCA
Position: -113
Score: 5.5
Sequence: ATTGTGGACAATTTCTCACCATT
Locus tag: cauri_0643
Name: gabT2
Funciton: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
Locus tag: cauri_0642
Name: hapE
Funciton: 4-hydroxyacetophenone monooxygenase (EC 1.14.13.84)
Locus tag: cauri_0641
Name: lipN
Funciton: Putative lipase/esterase
gabT2
Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
hapE
4-hydroxyacetophenone monooxygenase (EC 1.14.13.84)
lipN
Putative lipase/esterase

Position: -44
Score: 5.4
Sequence: AGGGTGTATAAATTTTGCACCTA
Locus tag: cauri_0645
Name: gabR
Funciton: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family
gabR
Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family

Position: -45
Score: 4
Sequence: ATGGGGTGCAACCCATACACACT
Locus tag: cauri_0649
Name: gabD1
Funciton: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
Locus tag: cauri_0648
Name: cauri_0648
Funciton: Hypothetical protein
gabD1
Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
cauri_0648
Hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD