Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Beutenbergia cavernae DSM 12333

Properties
Regulator type: Transcription factor
TF locus tag: Bcav_2841
Regulator family: LacI
Regulation mode:
Biological process: Cellobiose utilization
Effector: Cellobiose
Regulog: CelR - Micrococcineae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -132
Score: 6.1
Sequence: CCGTGAGAGCGCTCCCATGG
Position: -96
Score: 6
Sequence: CCTTGGGAGCGCTCTCACCA
Locus tag: Bcav_2837
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: Bcav_2838
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: Bcav_2839
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: Bcav_2840
Name: bglC
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Bcav_2841
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE
Cellobiose specific ABC transporter, substrate-binding protein
cebF
Cellobiose specific ABC transporter, permease protein 1
cebG
Cellobiose specific ABC transporter, permease protein 2
bglC
Beta-glucosidase (EC 3.2.1.21)
celR
Cellobiose utilization transcriptional regulator CelR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD