Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_3401 in Roseiflexus castenholzii DSM 13941

Properties
Regulator type: Transcription factor
TF locus tag: Rcas_4171
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: Caur_3401 - Chloroflexia
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -156
Score: 6.6
Sequence: ATTTTACTGTATAGTAGTCT
Locus tag: Rcas_4170
Name: acrB
Funciton: Probable multidrug efflux system from RND family, AcrB pore domain
Locus tag: Rcas_4169
Name: hlyD
Funciton: secretion protein HlyD family protein
acrB
Probable multidrug efflux system from RND family, AcrB pore domain
hlyD
secretion protein HlyD family protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD