Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AcrR in Chloroflexus aggregans DSM 9485

Properties
Regulator type: Transcription factor
TF locus tag: Cagg_0421, Cagg_2437
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Regulog: AcrR - Chloroflexia
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -44
Score: 6.9
Sequence: ATTACTTACCGGTCGGTAAGAATT
Locus tag: Cagg_2437
Name: acrR
Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Locus tag: Cagg_2438
Name: acrA
Funciton: Probable multidrug efflux system from RND family, membrane fusion protein
Locus tag: Cagg_2439
Name: salX
Funciton: ABC transporter related protein SalX
Locus tag: Cagg_2440
Name: salY
Funciton: Putative cell division protein SalY
acrR
Predicted transcriptional regulator of multidrug efflux transporter, TetR family
acrA
Probable multidrug efflux system from RND family, membrane fusion protein
salX
ABC transporter related protein SalX
salY
Putative cell division protein SalY

Position: -51
Score: 6.1
Sequence: GTTACCGACCGGTCGGTCGGTTTT
Locus tag: Cagg_0420
Name: Cagg_0420
Funciton: Multidrug transporter, MFS superfamily
Locus tag: Cagg_0421
Name: acrR
Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Cagg_0420
Multidrug transporter, MFS superfamily
acrR
Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD