Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_3866 in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_4175
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: Caur_3866 - Chloroflexia
Statistics of regulated genes:
- Genes 14
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -193
Score: 5.9
Sequence: CGTATGAAACGTTACACAAA
Position: -88
Score: 6.1
Sequence: GTAATGAAACGTTTCATACC
Locus tag: Chy400_4165
Name: COG3459
Funciton: Cellobiose phosphorylase
Locus tag: Chy400_4166
Name: Caur_3857
Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Chy400_4167
Name: Caur_3858
Funciton: Putative sugar ABC transporter, solute-binding component
Locus tag: Chy400_4168
Name: Caur_3859
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4169
Name: Caur_3860
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4170
Name: tolB
Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein
Locus tag: Chy400_4171
Name: Caur_3862
Funciton: hypothetical protein
Locus tag: Chy400_4172
Name: Caur_3863
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4173
Name: Caur_3864
Funciton: Putative sugar ABC transporter, inner membrane component
Locus tag: Chy400_4174
Name: COG5368
Funciton: conserved hypothetical protein
Locus tag: Chy400_4175
Name: bglR
Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Locus tag: Chy400_4176
Name: Caur_3867
Funciton: conserved hypothetical protein
Locus tag: Chy400_4177
Name: GH35
Funciton: glycoside hydrolase family 35
Locus tag: Chy400_4178
Name: bglX
Funciton: Beta-glucosidase-related glycosidase
COG3459
Cellobiose phosphorylase
Caur_3857
Putative sugar ABC transporter, solute-binding component
Caur_3858
Putative sugar ABC transporter, solute-binding component
Caur_3859
Putative sugar ABC transporter, inner membrane component
Caur_3860
Putative sugar ABC transporter, inner membrane component
tolB
Hypothetical six-bladed beta-propeller, TolB-like protein
Caur_3862
hypothetical protein
Caur_3863
Putative sugar ABC transporter, inner membrane component
Caur_3864
Putative sugar ABC transporter, inner membrane component
COG5368
conserved hypothetical protein
bglR
Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Caur_3867
conserved hypothetical protein
GH35
glycoside hydrolase family 35
bglX
Beta-glucosidase-related glycosidase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD