Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IolR in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_7156
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR - Streptomycetaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -135
Score: 6.2
Sequence: TCTTTGGACCGGTCCAAAAT
Position: -20
Score: 5.9
Sequence: GATGTGGAACGGTCCAAGAG
Locus tag: SAV_7156
Name: iolR
Funciton: Inositol utilization transcriptional regulator IolR, LacI family
iolR
Inositol utilization transcriptional regulator IolR, LacI family

Position: -144
Score: 5.9
Sequence: CTCTTGGACCGTTCCACATC
Position: -29
Score: 6.2
Sequence: ATTTTGGACCGGTCCAAAGA
Locus tag: SAV_7155
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
iolG
Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD