Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Thermoanaerobacter ethanolicus X514

Properties
Regulator type: Transcription factor
TF locus tag: Teth514_0161
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Thermoanaerobacterales
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -53
Score: 6.4
Sequence: ATAGTTAAGCGTTTTACTAA
Position: -40
Score: 6
Sequence: TTACTAAAACGTTAAACCAA
Locus tag: Teth514_0161
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: Teth514_0162
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Teth514_0163
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Teth514_0164
Name: rbsA
Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: Teth514_0165
Name: rbsC
Funciton: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
Locus tag: Teth514_0166
Name: rbsB
Funciton: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
rbsR
Transcriptional repressor of ribose utilization, LacI famil
rbsK
Ribokinase (EC 2.7.1.15)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
rbsC
Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
rbsB
Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD