Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Stenotrophomonas maltophilia K279a

Properties
Regulator type: Transcription factor
TF locus tag: Smlt1186
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltodextrin utilization; Maltose utilization
Effector: Maltose
Regulog: MalR - Xanthomonadales
Statistics of regulated genes:
- Genes 6
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -90
Score: 5.9
Sequence: AGCTGCATACGTATTCATGG
Locus tag: Smlt1176
Name: susB
Funciton: Alpha-glucosidase (EC 3.2.1.20)
susB
Alpha-glucosidase (EC 3.2.1.20)

Position: -91
Score: 6.4
Sequence: GCGTGAATACGTATGCAGGT
Locus tag: Smlt1174
Name: malZ
Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
malZ
Maltodextrin glucosidase (EC 3.2.1.20)

Position: -12
Score: 6.7
Sequence: CATTGAATACGTATGCAGGG
Locus tag: Smlt1175
Name: omp(Mal)
Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent
omp(Mal)
Predicted maltose-specific outer membrane transporter, TonB-dependent

Position: -101
Score: 6.5
Sequence: CCATGAATACGTATGCAGCT
Locus tag: Smlt1177
Name: COG3408
Funciton: Glycogen debranching enzyme
Locus tag: Smlt1178
Name: malT
Funciton: Predicted maltose transporter MalT
Locus tag: Smlt1179
Name: cgt
Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
COG3408
Glycogen debranching enzyme
malT
Predicted maltose transporter MalT
cgt
Cyclomaltodextrin glucanotransferase EC=2.4.1.19
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD