Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdxR3 in Methylibium petroleiphilum PM1

Properties
Regulator type: Transcription factor
TF locus tag: Mpe_A2441
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -217
Score: 4.3
Sequence: GATCCACTTCGCTCGAAGTGGATT
Position: -141
Score: 5
Sequence: TGGCCAATCGCCTGATAGTGGATC
Locus tag: Mpe_A2441
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family

Position: -147
Score: 5
Sequence: GATCCACTATCAGGCGATTGGCCA
Position: -71
Score: 4.3
Sequence: AATCCACTTCGAGCGAAGTGGATC
Locus tag: Mpe_A2442
Name: COG0596
Funciton: Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily)
Locus tag: Mpe_A2443
Name: COG0657
Funciton: Esterase/lipase
COG0596
Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily)
COG0657
Esterase/lipase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD