Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdxR3 in Rhodococcus opacus B4

Properties
Regulator type: Transcription factor
TF locus tag: ROP_56250, ROP_64330
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Nocardiaceae
Statistics of regulated genes:
- Genes 4
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -137
Score: 4
Sequence: AGTCCAGAAGATCCGGACTGGACC
Locus tag: ROP_56230
Name: COG0350
Funciton: Methylated DNA-protein cysteine methyltransferase
COG0350
Methylated DNA-protein cysteine methyltransferase

Position: -200
Score: 3.2
Sequence: CGGCCAGCCGTTGTATCGCGGGCT
Locus tag: ROP_64330
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family

Position: -238
Score: 3.5
Sequence: ACGCCGGCTTCACGGAGGTGGCAC
Position: -160
Score: 3.6
Sequence: GGTCCAGTAACGCCGACATGGCTA
Locus tag: ROP_65020
Name: COG2364
Funciton: Predicted membrane protein
COG2364
Predicted membrane protein

Position: -239
Score: 4
Sequence: GGTCCAGTCCGGATCTTCTGGACT
Position: -29
Score: 4.1
Sequence: TAGCCAAGGGGGTGATACTGGACT
Locus tag: ROP_56250
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD