Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdxR3 in Rhodococcus erythropolis PR4

Properties
Regulator type: Transcription factor
TF locus tag: RER_14310
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Nocardiaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -93
Score: 3.3
Sequence: ATGCGGGCTTCACGGAAGTGGCAC
Position: -23
Score: 4.7
Sequence: AGTCCAGTATCGACAACTTGGCTA
Locus tag: RER_23600
Name: COG2364
Funciton: Predicted membrane protein
COG2364
Predicted membrane protein

Position: -26
Score: 4.7
Sequence: TAGCCAAGTTGTCGATACTGGACT
Locus tag: RER_14310
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD