Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdxR3 in Nocardia farcinica IFM 10152

Properties
Regulator type: Transcription factor
TF locus tag: nfa53660
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Nocardiaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 5.7
Sequence: AGTCCAGTTTCGAAAAACTGGACT
Locus tag: nfa53680
Name: COG0350
Funciton: Methylated DNA-protein cysteine methyltransferase
COG0350
Methylated DNA-protein cysteine methyltransferase

Position: -26
Score: 4.9
Sequence: TAGCCAATCCGCGAATACTGGACT
Locus tag: nfa53660
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD