Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XAC1548 in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC1500
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: XAC1548 - Xanthomonadales
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 5.3
Sequence: CGGTGTACTACCTTACTACCACACCA
Locus tag: XCC0210
Name: XAC0231
Funciton: hypothetical protein
XAC0231
hypothetical protein

Position: -299
Score: 6.3
Sequence: CGGTGTTATAGTTGAATACAAAACCA
Locus tag: XCC1500
Name: XAC1548
Funciton: Transcriptional regulator, GntR family
Locus tag: XCC1499
Name: XAC1547
Funciton: ABC transporter, ATP-binding protein
Locus tag: XCC1498
Name: XAC1546
Funciton: ABC transporter, permease protein
XAC1548
Transcriptional regulator, GntR family
XAC1547
ABC transporter, ATP-binding protein
XAC1546
ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD