Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AAur_2567 in Renibacterium salmoninarum ATCC 33209

Properties
Regulator type: Transcription factor
TF locus tag: RSal33209_1480
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: AAur_2567 - Micrococcineae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 5.7
Sequence: TTAGGTTAGTTGTATGAGTAATGAACCGGC
Locus tag: RSal33209_1480
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
AAur_2567
Transcriptional regulator, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD