Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AAur_2567 in Brachybacterium faecium DSM 4810

Properties
Regulator type: Transcription factor
TF locus tag: Bfae_06980
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: AAur_2567 - Micrococcineae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -66
Score: 6.4
Sequence: CATGGTTCATTAGTGGAGTAATGAACCAAC
Locus tag: Bfae_06980
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: Bfae_06990
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Bfae_07000
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567
Transcriptional regulator, GntR family
lp_2743
ABC-type multidrug transport system, ATPase component
lp_2744
ABC-type multidrug transport system, permease component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD