Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AzrR in Shewanella putrefaciens CN-32

Properties
Regulator type: Transcription factor
TF locus tag: Sputcn32_1018
Regulator family: [Other]
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: AzrR - Shewanellaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -104
Score: 6.5
Sequence: CTTTATTTAATCTTGTAAAG
Position: -66
Score: 5.1
Sequence: GTTTATTTAATCTGTTAAAG
Locus tag: Sputcn32_1018
Name: azrR
Funciton: putative transcriptional regulator of azoreductase, AsnC family
azrR
putative transcriptional regulator of azoreductase, AsnC family

Position: -100
Score: 5.1
Sequence: CTTTAACAGATTAAATAAAC
Position: -62
Score: 6.5
Sequence: CTTTACAAGATTAAATAAAG
Locus tag: Sputcn32_1017
Name: azr
Funciton: NADPH-dependent FMN reductase
Locus tag: Sputcn32_1016
Name: SO3586
Funciton: Glyoxalase family protein
azr
NADPH-dependent FMN reductase
SO3586
Glyoxalase family protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD