Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ExuR in Clostridium acetobutylicum ATCC 824

Properties
Regulator type: Transcription factor
TF locus tag: CAC0693
Regulator family: LacI
Regulation mode: repressor
Biological process: Galacturonate utilization
Effector: Galacturonate
Regulog: ExuR - Clostridia-1
Statistics of regulated genes:
- Genes 14
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -130
Score: 5.4
Sequence: AAATGTTCACGTGTTCAAAA
Position: -42
Score: 5.2
Sequence: TTTTGAACACGTGAACGTAA
Locus tag: CAC0695
Name: uxaB
Funciton: Altronate oxidoreductase (EC 1.1.1.58)
Locus tag: CAC0696
Name: uxaA
Funciton: Altronate hydrolase (EC 4.2.1.7)
uxaB
Altronate oxidoreductase (EC 1.1.1.58)
uxaA
Altronate hydrolase (EC 4.2.1.7)

Position: -121
Score: 5.7
Sequence: AGTTGTTCACGTTCACAAAA
Locus tag: CAC0692
Name: uxaC
Funciton: Uronate isomerase (EC 5.3.1.12)
Locus tag: CAC0693
Name: exuR
Funciton: Hexuronate utilization transcriptional repressor ExuR, LacI family
Locus tag: CAC0694
Name: uxaT
Funciton: Galacturonate transporter UxaT
uxaC
Uronate isomerase (EC 5.3.1.12)
exuR
Hexuronate utilization transcriptional repressor ExuR, LacI family
uxaT
Galacturonate transporter UxaT

Position: -46
Score: 6.1
Sequence: AAATGTTAACGTTAACATAA
Locus tag: CAP0056
Name: pell
Funciton: Pectate lyase, secreted, polysaccharide lyase family
pell
Pectate lyase, secreted, polysaccharide lyase family

Position: -51
Score: 5.3
Sequence: TTTTGTTAACGTTATCTGTA
Position: -38
Score: 4.5
Sequence: ATCTGTATACGATAACAATT
Locus tag: CAC2774
Name: mcp
Funciton: Methyl-accepting chemotaxis protein with HAMP domain
mcp
Methyl-accepting chemotaxis protein with HAMP domain

Position: -106
Score: 4.5
Sequence: TAATGTAATTGTTAACGTTA
Position: -100
Score: 5.4
Sequence: AATTGTTAACGTTAAACAAA
Position: -42
Score: 4.6
Sequence: TATGTTTATCGTAAACAAAA
Locus tag: CAC0804
Name: pelA
Funciton: Exopolygalacturonate lyase
pelA
Exopolygalacturonate lyase

Position: -167
Score: 5.7
Sequence: GTTTGTTAACGATAACAATA
Locus tag: CAC0812
Name: pelL
Funciton: Pectate transeliminase, secreted
pelL
Pectate transeliminase, secreted

Position: -195
Score: 5.7
Sequence: CTTTGTTAACGTTAACGTAA
Position: -72
Score: 5.7
Sequence: TATTGATAACGTGAACACTA
Locus tag: CAC0359
Name: rhiN
Funciton: Rhamnogalacturonides degradation protein RhiN
Locus tag: CAC0358
Name: PF01522
Funciton: Polysaccharide deacetylase
Locus tag: CAC0357
Name: rhiT
Funciton: Putative rhamnogalacturonide transporter
Locus tag: CAC0356
Name: PF02589
Funciton: Domain of unknown function DUF162
Locus tag: CAC0355
Name: pgl
Funciton: Polygalacturonase (EC 3.2.1.15)
rhiN
Rhamnogalacturonides degradation protein RhiN
PF01522
Polysaccharide deacetylase
rhiT
Putative rhamnogalacturonide transporter
PF02589
Domain of unknown function DUF162
pgl
Polygalacturonase (EC 3.2.1.15)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD