Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ExuR in Clostridium butyricum 5521

Properties
Regulator type: Transcription factor
TF locus tag: CBY_3741
Regulator family: LacI
Regulation mode: repressor
Biological process: Galacturonate utilization
Effector: Galacturonate
Regulog: ExuR - Clostridia-1
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -197
Score: 4.5
Sequence: TTTGGAAAACGTGTTCAATT
Position: -96
Score: 5
Sequence: AAATGTGCACGTGTGCAAAA
Locus tag: CBY_0243
Name: rhiN
Funciton: Rhamnogalacturonides degradation protein RhiN
Locus tag: CBY_0242
Name: PF02589
Funciton: Domain of unknown function DUF162
Locus tag: CBY_0241
Name: PF01522
Funciton: Polysaccharide deacetylase
Locus tag: CBY_0240
Name: rhiT
Funciton: Putative rhamnogalacturonide transporter
Locus tag: CBY_0239
Name: pgl
Funciton: Polygalacturonase (EC 3.2.1.15)
rhiN
Rhamnogalacturonides degradation protein RhiN
PF02589
Domain of unknown function DUF162
PF01522
Polysaccharide deacetylase
rhiT
Putative rhamnogalacturonide transporter
pgl
Polygalacturonase (EC 3.2.1.15)

Position: -43
Score: 6
Sequence: AATTGTTAACGATAACAATA
Locus tag: CBY_3715
Name: null
Funciton: Pectate lyase, secreted, polysaccharide lyase family
Pectate lyase, secreted, polysaccharide lyase family

Position: -122
Score: 5.3
Sequence: AATTGTTAACGTTAAACTTA
Position: -34
Score: 5.9
Sequence: AATTGTTAACGTTAACTATA
Locus tag: CBY_2353
Name: pelX
Funciton: Exopolygalacturonate lyase
pelX
Exopolygalacturonate lyase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD