Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SgaR in Yersinia pestis KIM

Properties
Regulator type: Transcription factor
TF locus tag: y1619
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Regulog: SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -190
Score: 5.9
Sequence: AATTGATAGCGCTATCTGGT
Position: -177
Score: 5.9
Sequence: ATCTGGTAGCGCTATCAAAA
Position: -156
Score: 6.3
Sequence: TTGTGATAGCGCTATCATTT
Locus tag: y1619
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR
Ascorbate utilization transcriptional regulator SgaR, LacI family

Position: -128
Score: 6.3
Sequence: AAATGATAGCGCTATCACAA
Position: -107
Score: 5.9
Sequence: TTTTGATAGCGCTACCAGAT
Position: -94
Score: 5.9
Sequence: ACCAGATAGCGCTATCAATT
Locus tag: y1618
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
sgaA
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD