Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SgaR in Edwardsiella tarda EIB202

Properties
Regulator type: Transcription factor
TF locus tag: ETAE_3025
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Regulog: SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -122
Score: 6.1
Sequence: AAATGATAGCGCTATCACGA
Position: -88
Score: 5.8
Sequence: ACTAGATAGCGCTACCATTG
Locus tag: ETAE_3026
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: ETAE_3027
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: ETAE_3028
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
sgaA
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
sgaB
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
sgaT
Ascorbate-specific PTS system, EIIC component

Position: -242
Score: 5.8
Sequence: CAATGGTAGCGCTATCTAGT
Position: -208
Score: 6.1
Sequence: TCGTGATAGCGCTATCATTT
Locus tag: ETAE_3025
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR
Ascorbate utilization transcriptional regulator SgaR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD