Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SgaR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type: Transcription factor
TF locus tag: CKO_00488
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Regulog: SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -175
Score: 6.1
Sequence: CAAAGATAGCGCTATCAAAA
Position: -141
Score: 6.2
Sequence: ATGTGATAGCGCTATCAAAA
Locus tag: CKO_00488
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR
Ascorbate utilization transcriptional regulator SgaR, LacI family

Position: -162
Score: 6.2
Sequence: TTTTGATAGCGCTATCACAT
Position: -128
Score: 6.1
Sequence: TTTTGATAGCGCTATCTTTG
Locus tag: CKO_00489
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: CKO_00490
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: CKO_00491
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: CKO_00492
Name: tktA
Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: CKO_00493
Name: tktB
Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
sgaA
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
sgaB
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
sgaT
Ascorbate-specific PTS system, EIIC component
tktA
Transketolase, N-terminal section (EC 2.2.1.1)
tktB
Transketolase, C-terminal section (EC 2.2.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD