Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BglR in Thermus thermophilus HB27

Properties
Regulator type: Transcription factor
TF locus tag: TTP0038
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Deinococcus-Thermus
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -21
Score: 6.3
Sequence: TCTTGCAAGCGCTTTCAACA
Locus tag: TTP0038
Name: bglR
Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: TTP0039
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: TTP0040
Name: bglF
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: TTP0041
Name: bglG
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: TTP0042
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglR
Transcriptional regulator for beta-glucoside utilization, LacI family
bglE
Predicted beta-glucoside ABC transporter, periplasmic component
bglF
Predicted beta-glucoside ABC transporter, permease component
bglG
Predicted beta-glucoside ABC transporter, permease component
bglB
Beta-glucosidase (EC 3.2.1.21)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD