Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SCO1956 in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_6288
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: SCO1956 - Streptomycetaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -100
Score: 7.7
Sequence: AAACGCTTGCGCAAGCGTTT
Locus tag: SAV_6288
Name: SCO1956
Funciton: Transcriptional regulator, LacI family
Locus tag: SAV_6287
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
SCO1956
Transcriptional regulator, LacI family
scrK
Fructokinase (EC 2.7.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD