Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO2745
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Streptomycetaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -35
Score: 6.8
Sequence: CCGTGTAATCGATTCCACGA
Locus tag: SCO2745
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: SCO2746
Name: rbsA
Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: SCO2747
Name: rbsBC
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: SCO2748
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: SCO2749
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsR
Transcriptional repressor of ribose utilization, LacI famil
rbsA
Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
rbsBC
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsK
Ribokinase (EC 2.7.1.15)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD