Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SCO5692 in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_25511
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: SCO5692 - Streptomycetaceae
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -248
Score: 6.2
Sequence: CAGTCGAAGCGCTTCGATGT
Position: -53
Score: 6.5
Sequence: GCATCGAAGCGCTTCGAAAG
Locus tag: SCAB_25641
Name: bglX
Funciton: Glycoside hydrolase
bglX
Glycoside hydrolase

Position: -125
Score: 6.3
Sequence: TGATCGAAGCGCTTCGACAA
Locus tag: SCAB_25511
Name: SCO5692
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
SCO5692
Predicted sugar utilization transcriptional regulator, LacI family

Position: -151
Score: 6.7
Sequence: ACATCGAAGCGCTTCGACTG
Locus tag: SCAB_25621
Name: SAV_2577
Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SCAB_25611
Name: SAV_2576
Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SCAB_25601
Name: SAV_2575
Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SCAB_25591
Name: SAV_2574
Funciton: Predicted glycosyl hydrolase
Locus tag: SCAB_25581
Name: SAV_2573
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SCAB_25571
Name: SAV_2571
Funciton: Predicted sugar hydrolase
SAV_2577
Predicted multiple sugar ABC transporter, substrate-binding protein
SAV_2576
Predicted multiple sugar ABC transporter, permease protein 1
SAV_2575
Predicted multiple sugar ABC transporter, permease protein 2
SAV_2574
Predicted glycosyl hydrolase
SAV_2573
Beta-galactosidase (EC 3.2.1.23)
SAV_2571
Predicted sugar hydrolase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD