Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SCO5692 in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO5692
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: SCO5692 - Streptomycetaceae
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -160
Score: 6.2
Sequence: GTGTCGAAGCGCTTCGATGT
Position: -51
Score: 6.7
Sequence: GCATCGAAGCGCTTCGACGT
Locus tag: SCO5685
Name: bglX
Funciton: Glycoside hydrolase
bglX
Glycoside hydrolase

Position: -124
Score: 6.9
Sequence: GAGTCGAAGCGCTTCGACGG
Locus tag: SCO5692
Name: SCO5692
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
SCO5692
Predicted sugar utilization transcriptional regulator, LacI family

Position: -218
Score: 6.3
Sequence: ACGTCGAAGCGCTTCGATGC
Position: -109
Score: 6.7
Sequence: ACATCGAAGCGCTTCGACAC
Locus tag: SCO5686
Name: SAV_2577
Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SCO5687
Name: SAV_2576
Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SCO5688
Name: SAV_2575
Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SCO5689
Name: SAV_2573
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SCO5690
Name: SAV_2572
Funciton: Predicted secreted protein
Locus tag: SCO5691
Name: SAV_2571
Funciton: Predicted sugar hydrolase
SAV_2577
Predicted multiple sugar ABC transporter, substrate-binding protein
SAV_2576
Predicted multiple sugar ABC transporter, permease protein 1
SAV_2575
Predicted multiple sugar ABC transporter, permease protein 2
SAV_2573
Beta-galactosidase (EC 3.2.1.23)
SAV_2572
Predicted secreted protein
SAV_2571
Predicted sugar hydrolase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD