Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SuxR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type: Transcription factor
TF locus tag: XAC3487
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Regulog: SuxR - Xanthomonadales
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -78
Score: 7.3
Sequence: CGTTACAATCGATTGCAACG
Locus tag: XAC3488
Name: sut1
Funciton: Sucrose transport protein SUT1
sut1
Sucrose transport protein SUT1

Position: -190
Score: 7.3
Sequence: CGTTGCAATCGATTGTAACG
Locus tag: XAC3489
Name: omp_suc
Funciton: Predicted sucrose-specific outer membrane transporter, TonB-dependent
Locus tag: XAC3490
Name: ams
Funciton: Amylosucrase
omp_suc
Predicted sucrose-specific outer membrane transporter, TonB-dependent
ams
Amylosucrase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD