Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SCO2753 in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_5312
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector: New effector
Regulog: SCO2753 - Streptomycetaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 6.6
Sequence: CATAGAAAGCGCTTGCTGCG
Locus tag: SAV_5313
Name: SCO2752
Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: SAV_5314
Name: SCO2751
Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: SAV_5315
Name: SCO2750
Funciton: Predicted sugar phosphate isomerases/epimerase
SCO2752
Predicted glucose-fructose oxidoreductase
SCO2751
Conserved hypothetical protein, potentially related to sugar utilization
SCO2750
Predicted sugar phosphate isomerases/epimerase

Position: -182
Score: 6.6
Sequence: CGCAGCAAGCGCTTTCTATG
Locus tag: SAV_5312
Name: SCO2753
Funciton: Sugar utilization transctriptional regulator, LacI family
SCO2753
Sugar utilization transctriptional regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD