Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BgaR in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_1031
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Streptomycetaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -110
Score: 6.9
Sequence: AGATGTTTACGTAAACATAA
Locus tag: SAV_1030
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: SAV_1029
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: SAV_1028
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
Locus tag: SAV_1027
Name: bgaB
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SAV_1026
Name: gal6
Funciton: Endo-beta-1,6-galactanase
bgaZ
Putative beta-galactoside ABC transport system, permease component 1
bgaY
Putative beta-galactoside ABC transport system, permease component 2
bgaX
Putative beta-galactoside ABC transport system, periplasmic component
bgaB
Beta-galactosidase (EC 3.2.1.23)
gal6
Endo-beta-1,6-galactanase

Position: -92
Score: 6.9
Sequence: TTATGTTTACGTAAACATCT
Locus tag: SAV_1031
Name: bgaR
Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
bgaR
Putative transcriptional regulator for beta-galactosides utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD