Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BgaR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_43681
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Streptomycetaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -186
Score: 7.2
Sequence: GGATGTTTACGTAAACATCC
Locus tag: SCAB_43661
Name: gal6
Funciton: Endo-beta-1,6-galactanase
gal6
Endo-beta-1,6-galactanase

Position: -184
Score: 7.2
Sequence: GGATGTTTACGTAAACATCC
Locus tag: SCAB_43681
Name: bgaR
Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
bgaR
Putative transcriptional regulator for beta-galactosides utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD