Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RhaR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_9371
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Regulog: RhaR - Streptomycetaceae
Statistics of regulated genes:
- Genes 19
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -235
Score: 6.2
Sequence: TGTCTGAAACGATTCAGCAA
Locus tag: SCAB_9431
Name: rhaG
Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SCAB_9421
Name: rhaH
Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SCAB_9411
Name: rhaJ
Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SCAB_9401
Name: rhaF
Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SCAB_9391
Name: rhaM
Funciton: L-rhamnose mutarotase
Locus tag: SCAB_9381
Name: rhaX
Funciton: Putative rhamnoside hydrolase
Locus tag: SCAB_9371
Name: rhaR
Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG
L-rhamnose ABC transporter, duplicated ATP-binding component
rhaH
L-rhamnose ABC transporter, permease component 1
rhaJ
L-rhamnose ABC transporter, permease component 2
rhaF
L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
rhaM
L-rhamnose mutarotase
rhaX
Putative rhamnoside hydrolase
rhaR
Rhamnose utilization transcriptional regulator RhaR, LacI family

Position: -43
Score: 6.2
Sequence: TTGCTGAATCGTTTCAGACA
Locus tag: SCAB_9441
Name: rhaI
Funciton: L-rhamnose isomerase (EC 5.3.1.14)
Locus tag: SCAB_9451
Name: rhaEW
Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
Locus tag: SCAB_9461
Name: rhaB
Funciton: Rhamnulokinase (EC 2.7.1.5)
Locus tag: SCAB_9471
Name: lldE
Funciton: L-lactate dehydrogenase, Fe-S oxidoreductase subunit
Locus tag: SCAB_9481
Name: lldF
Funciton: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
Locus tag: SCAB_9491
Name: lldG
Funciton: L-lactate dehydrogenase, hypothetical subunit
rhaI
L-rhamnose isomerase (EC 5.3.1.14)
rhaEW
Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
rhaB
Rhamnulokinase (EC 2.7.1.5)
lldE
L-lactate dehydrogenase, Fe-S oxidoreductase subunit
lldF
L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
lldG
L-lactate dehydrogenase, hypothetical subunit

Position: -50
Score: 4.2
Sequence: TACTTGAAACGATTCACGGC
Locus tag: SCAB_74641
Name: rhiL
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: SCAB_74651
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: SCAB_74661
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: SCAB_74671
Name: SAV_6815
Funciton: hypothetical protein
rhiL
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
rhiF
Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiG
Putatuve rhamnogalacturonides ABC transporter, permease component 2
SAV_6815
hypothetical protein

Position: -54
Score: 4.1
Sequence: GTGATGAAACGTTTTAATCC
Locus tag: SCAB_86701
Name: SCF41.28c
Funciton: putative secreted protein
Locus tag: SCAB_86711
Name: null
Funciton: putative exported rhamnosidase A
SCF41.28c
putative secreted protein
putative exported rhamnosidase A
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD