Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RhaR in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO0806
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Regulog: RhaR - Streptomycetaceae
Statistics of regulated genes:
- Genes 20
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -228
Score: 6.1
Sequence: TGTGTGAAACGATTCAGAAC
Locus tag: SCO0811
Name: rhaG
Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SCO0810
Name: rhaH
Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SCO0809
Name: rhaJ
Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SCO0808
Name: rhaF
Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SCO0807
Name: rhaM
Funciton: L-rhamnose mutarotase
Locus tag: SCO0806
Name: rhaR
Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG
L-rhamnose ABC transporter, duplicated ATP-binding component
rhaH
L-rhamnose ABC transporter, permease component 1
rhaJ
L-rhamnose ABC transporter, permease component 2
rhaF
L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
rhaM
L-rhamnose mutarotase
rhaR
Rhamnose utilization transcriptional regulator RhaR, LacI family

Position: -68
Score: 6.1
Sequence: GTTCTGAATCGTTTCACACA
Locus tag: SCO0812
Name: rhaI
Funciton: L-rhamnose isomerase (EC 5.3.1.14)
Locus tag: SCO0813
Name: rhaEW
Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
Locus tag: SCO0814
Name: rhaB
Funciton: Rhamnulokinase (EC 2.7.1.5)
Locus tag: SCO0815
Name: lldE
Funciton: L-lactate dehydrogenase, Fe-S oxidoreductase subunit
Locus tag: SCO0816
Name: lldF
Funciton: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
Locus tag: SCO0817
Name: lldG
Funciton: L-lactate dehydrogenase, hypothetical subunit
rhaI
L-rhamnose isomerase (EC 5.3.1.14)
rhaEW
Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
rhaB
Rhamnulokinase (EC 2.7.1.5)
lldE
L-lactate dehydrogenase, Fe-S oxidoreductase subunit
lldF
L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
lldG
L-lactate dehydrogenase, hypothetical subunit

Position: -53
Score: 4.3
Sequence: GGATTGAATCGATTCAATCA
Locus tag: SCO0372
Name: rhmA2
Funciton: Predicted alpha-L-rhamnosidase
rhmA2
Predicted alpha-L-rhamnosidase

Position: -48
Score: 4.8
Sequence: TACTTGAAACGATTCATGAG
Locus tag: SCO1539
Name: rhiL
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: SCO1538
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: SCO1537
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
rhiL
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
rhiF
Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiG
Putatuve rhamnogalacturonides ABC transporter, permease component 2

Position: -41
Score: 4
Sequence: CGAGTAAAACGATTCAATCG
Locus tag: SCO0371
Name: SCF41.30c
Funciton: COG3533 secreted protein
Locus tag: SCO0370
Name: SCF41.29c
Funciton: Predicted alpha-L-rhamnosidase
Locus tag: SCO0369
Name: SCF41.28c
Funciton: putative secreted protein
SCF41.30c
COG3533 secreted protein
SCF41.29c
Predicted alpha-L-rhamnosidase
SCF41.28c
putative secreted protein

Position: 22
Score: 4.9
Sequence: CGGTTGAAACGTTTCAAGCG
Locus tag: SCO0488
Name: rhmA3
Funciton: putative rhamnosidase
rhmA3
putative rhamnosidase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD