Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RhaR in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_7422
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Regulog: RhaR - Streptomycetaceae
Statistics of regulated genes:
- Genes 18
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -225
Score: 5.9
Sequence: CGTATGAAACGATTCAGGAG
Locus tag: SAV_7416
Name: rhaG
Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SAV_7417
Name: rhaH
Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SAV_7418
Name: rhaJ
Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SAV_7419
Name: rhaF
Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SAV_7420
Name: rhaM
Funciton: L-rhamnose mutarotase
Locus tag: SAV_7421
Name: rhaX
Funciton: Putative rhamnoside hydrolase
Locus tag: SAV_7422
Name: rhaR
Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG
L-rhamnose ABC transporter, duplicated ATP-binding component
rhaH
L-rhamnose ABC transporter, permease component 1
rhaJ
L-rhamnose ABC transporter, permease component 2
rhaF
L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
rhaM
L-rhamnose mutarotase
rhaX
Putative rhamnoside hydrolase
rhaR
Rhamnose utilization transcriptional regulator RhaR, LacI family

Position: -155
Score: 4.3
Sequence: GCTGTGAATCGATTCACCTT
Locus tag: SAV_828
Name: rhmA
Funciton: rhamnosidase
rhmA
rhamnosidase

Position: -52
Score: 4.7
Sequence: TACTTGAAACGATTCATGAC
Locus tag: SAV_6812
Name: rhiL
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: SAV_6813
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: SAV_6814
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: SAV_6815
Name: SAV_6815
Funciton: hypothetical protein
rhiL
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
rhiF
Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiG
Putatuve rhamnogalacturonides ABC transporter, permease component 2
SAV_6815
hypothetical protein

Position: -56
Score: 5.9
Sequence: CTCCTGAATCGTTTCATACG
Locus tag: SAV_7415
Name: rhaI
Funciton: L-rhamnose isomerase (EC 5.3.1.14)
Locus tag: SAV_7414
Name: rhaEW
Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
Locus tag: SAV_7413
Name: rhaB
Funciton: Rhamnulokinase (EC 2.7.1.5)
Locus tag: SAV_7412
Name: lldE
Funciton: L-lactate dehydrogenase, Fe-S oxidoreductase subunit
Locus tag: SAV_7411
Name: lldF
Funciton: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
Locus tag: SAV_7410
Name: lldG
Funciton: L-lactate dehydrogenase, hypothetical subunit
rhaI
L-rhamnose isomerase (EC 5.3.1.14)
rhaEW
Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
rhaB
Rhamnulokinase (EC 2.7.1.5)
lldE
L-lactate dehydrogenase, Fe-S oxidoreductase subunit
lldF
L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
lldG
L-lactate dehydrogenase, hypothetical subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD