Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ManR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_82731
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Regulog: ManR - Streptomycetaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -112
Score: 6.5
Sequence: GCGTGACAACGTTGTCCAGG
Locus tag: SCAB_82731
Name: manR
Funciton: Predicted mannoside utilization transcriptional regulator, LacI family
Locus tag: SCAB_82721
Name: SCO1079
Funciton: Conserved hypothetical protein
manR
Predicted mannoside utilization transcriptional regulator, LacI family
SCO1079
Conserved hypothetical protein

Position: -76
Score: 6.5
Sequence: CCTGGACAACGTTGTCACGC
Locus tag: SCAB_82741
Name: manK
Funciton: Predicted mannokinase, ROK family
manK
Predicted mannokinase, ROK family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD