Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ManR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type: Transcription factor
TF locus tag: SGR_6529
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Regulog: ManR - Streptomycetaceae
Statistics of regulated genes:
- Genes 3
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -133
Score: 6.4
Sequence: TGTTGACAACGTTGTCCAGG
Locus tag: SGR_6529
Name: manR
Funciton: Predicted mannoside utilization transcriptional regulator, LacI family
manR
Predicted mannoside utilization transcriptional regulator, LacI family

Position: -93
Score: 6.4
Sequence: CCTGGACAACGTTGTCAACA
Locus tag: SGR_6530
Name: manK
Funciton: Predicted mannokinase, ROK family
manK
Predicted mannokinase, ROK family

Position: -47
Score: 6.2
Sequence: CTATGACAACGTTGTCCAGG
Locus tag: SGR_1503
Name: manA
Funciton: Alpha-1,2-mannosidase
manA
Alpha-1,2-mannosidase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD