Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ManR in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO1078
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Regulog: ManR - Streptomycetaceae
Statistics of regulated genes:
- Genes 6
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -125
Score: 6.3
Sequence: ATCTGACAACGTTGTCCAGG
Locus tag: SCO1078
Name: manR
Funciton: Predicted mannoside utilization transcriptional regulator, LacI family
Locus tag: SCO1079
Name: SCO1079
Funciton: Conserved hypothetical protein
manR
Predicted mannoside utilization transcriptional regulator, LacI family
SCO1079
Conserved hypothetical protein

Position: -135
Score: 6.3
Sequence: CCTGGACAACGTTGTCAGAT
Locus tag: SCO1077
Name: manK
Funciton: Predicted mannokinase, ROK family
manK
Predicted mannokinase, ROK family

Position: -49
Score: 6.1
Sequence: GCGGGACAACGTTGTCAGGT
Locus tag: SCO6234
Name: manA2
Funciton: secreted beta-mannosidase
manA2
secreted beta-mannosidase

Position: -42
Score: 5.9
Sequence: ATTTGACAACGTTGTCCCAC
Locus tag: SCO6004
Name: manA
Funciton: Alpha-1,2-mannosidase
manA
Alpha-1,2-mannosidase

Position: -41
Score: 6.4
Sequence: GCTTGACAACGTTGTCCACC
Locus tag: SCO6428
Name: SCO6428
Funciton: putative secreted protein
SCO6428
putative secreted protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD