Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SAV1329 in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_1329
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: SAV1329 - Streptomycetaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -132
Score: 7.1
Sequence: TTCTGTGAGCGTTCACAGTA
Locus tag: SAV_1325
Name: lacA
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SAV_1324
Name: ganA
Funciton: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
lacA
Beta-galactosidase (EC 3.2.1.23)
ganA
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)

Position: -73
Score: 7.1
Sequence: TACTGTGAACGCTCACAGAA
Locus tag: SAV_1326
Name: SAV_1326
Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: SAV_1327
Name: SAV_1327
Funciton: Predicted galactosides ABC transporter, permease protein 1
Locus tag: SAV_1328
Name: SAV_1328
Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: SAV_1329
Name: SAV_1329
Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
SAV_1326
Predicted galactosides ABC transporter, substrate-binding protein
SAV_1327
Predicted galactosides ABC transporter, permease protein 1
SAV_1328
Predicted galactosides ABC transporter, permease protein 2
SAV_1329
Predicted galactosides utilization transcriptional regulator, LacI-family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD