Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR1 in Clostridium perfringens ATCC 13124

Properties
Regulator type: Transcription factor
TF locus tag: CPF_2649
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR1 - Clostridia-1
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 6.3
Sequence: AACTGGTATCGTTACCGAAA
Locus tag: CPF_2649
Name: malR1
Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
Locus tag: CPF_2648
Name: malZ
Funciton: Alpha-glucosidase (EC 3.2.1.20)
Locus tag: CPF_2647
Name: malQ
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: CPF_2646
Name: glgP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malR1
Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
malZ
Alpha-glucosidase (EC 3.2.1.20)
malQ
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
glgP
Maltodextrin phosphorylase (EC 2.4.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD