Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR1 in Clostridium novyi NT

Properties
Regulator type: Transcription factor
TF locus tag: NT01CX_0963
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR1 - Clostridia-1
Statistics of regulated genes:
- Genes 8
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 6.1
Sequence: TACCAGTAACGTTTCCAAAA
Locus tag: NT01CX_0963
Name: malR1
Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
Locus tag: NT01CX_0964
Name: malK
Funciton: Maltose/maltodextrin transporter, ATP-binding protein
Locus tag: NT01CX_0965
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: NT01CX_0966
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: NT01CX_0967
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: NT01CX_0968
Name: malZ
Funciton: Alpha-glucosidase (EC 3.2.1.20)
Locus tag: NT01CX_0969
Name: malQ
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: NT01CX_0970
Name: glgP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malR1
Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
malK
Maltose/maltodextrin transporter, ATP-binding protein
malE
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
Maltose/maltodextrin ABC transporter, permease protein 2
malG
Maltose/maltodextrin ABC transporter, permease protein 1
malZ
Alpha-glucosidase (EC 3.2.1.20)
malQ
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
glgP
Maltodextrin phosphorylase (EC 2.4.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD