Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ManR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC1507
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Regulog: ManR - Xanthomonadales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -231
Score: 5.5
Sequence: GCATTAGAACGATCTAATCG
Position: -118
Score: 4.3
Sequence: TCGTTGGATGGATACAAAGC
Locus tag: XCC1892
Name: omp(Man)
Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
omp(Man)
Mannosides-regulated TonB-dependent outer membrane receptor

Position: -132
Score: 6.2
Sequence: TAATTGGATCGATCCAATCA
Locus tag: XCC1507
Name: manR
Funciton: Mannose utilization transcriptional regulator ManR, LacI family
Locus tag: XCC1508
Name: manP
Funciton: Predicted mannose transporter, GGP family
Locus tag: XCC1509
Name: manK2
Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Locus tag: XCC1510
Name: manI2
Funciton: D-mannose isomerase (EC 5.3.1.7)
manR
Mannose utilization transcriptional regulator ManR, LacI family
manP
Predicted mannose transporter, GGP family
manK2
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
manI2
D-mannose isomerase (EC 5.3.1.7)

Position: -92
Score: 5.6
Sequence: GATTTGGATCGGTCCAAAGC
Locus tag: XCC4222
Name: omp(Man)-2
Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
Locus tag: XCC4221
Name: mnnA
Funciton: Alpha-1,2-mannosidase
omp(Man)-2
Mannosides-regulated TonB-dependent outer membrane receptor
mnnA
Alpha-1,2-mannosidase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD