Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ManR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type: Transcription factor
TF locus tag: XAC1555
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Regulog: ManR - Xanthomonadales
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -90
Score: 6.3
Sequence: TAATTGGATCGATCCAATTT
Locus tag: XAC1555
Name: manR
Funciton: Mannose utilization transcriptional regulator ManR, LacI family
Locus tag: XAC1556
Name: manP
Funciton: Predicted mannose transporter, GGP family
Locus tag: XAC1557
Name: manK2
Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Locus tag: XAC1558
Name: manI2
Funciton: D-mannose isomerase (EC 5.3.1.7)
manR
Mannose utilization transcriptional regulator ManR, LacI family
manP
Predicted mannose transporter, GGP family
manK2
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
manI2
D-mannose isomerase (EC 5.3.1.7)

Position: -229
Score: 5.5
Sequence: GCATTAGAACGATCTAATCG
Position: -117
Score: 4.9
Sequence: TCGTTGGATCGATACAAAGC
Locus tag: XAC1910
Name: omp(Man)
Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
omp(Man)
Mannosides-regulated TonB-dependent outer membrane receptor

Position: -302
Score: 5.7
Sequence: AGTTTAGATCGATCCAAGCC
Locus tag: XAC4355
Name: mnnA
Funciton: Alpha-1,2-mannosidase
mnnA
Alpha-1,2-mannosidase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD