Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of KojR in Anaerocellum thermophilum DSM 6725

Properties
Regulator type: Transcription factor
TF locus tag: Athe_0402
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Regulog: KojR - Thermoanaerobacterales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -181
Score: 5.1
Sequence: TTACGAAAACATTTCGAAAA
Position: -48
Score: 5.6
Sequence: CATCGAAAACATTTCCGAAA
Locus tag: Athe_0399
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: Athe_0400
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: Athe_0401
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
Locus tag: Athe_0402
Name: kojR
Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
kojE
Kojibiose ABC transporter, substrate-binding protein
kojF
Kojibiose ABC transporter, permease protein 1
kojG
Kojibiose ABC transporter, permease protein 2
kojR
Kojibiose utilization transcriptional regulator KojR, LacI family

Position: -70
Score: 4.8
Sequence: TATTGAAAACAATTCGAAAA
Locus tag: Athe_0397
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
Locus tag: Athe_0398
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
pgmB
Beta-phosphoglucomutase (EC 5.4.2.6)
kojP
Kojibiose phosphorylase (EC 2.4.1.230)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD