Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_57761, SCAB_2431
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose
Regulog: CelR - Streptomycetaceae
Statistics of regulated genes:
- Genes 14
- Operons 11
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -16
Score: 5.8
Sequence: CAATGGGAGCGCTTCCATGC
Locus tag: SCAB_57721
Name: bglC2
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglC2
Beta-glucosidase (EC 3.2.1.21)

Position: -85
Score: 6.1
Sequence: AAATGGGAGCGCTCCCAAAG
Locus tag: SCAB_5981
Name: gunA2
Funciton: Endoglucanase A (EC 3.2.1.4)
gunA2
Endoglucanase A (EC 3.2.1.4)

Position: -140
Score: 5.7
Sequence: TTTTGAGAGCGCTCTCAGGA
Locus tag: SCAB_15711
Name: lamA1
Funciton: Predicted endo-1,3-beta-glucanase
lamA1
Predicted endo-1,3-beta-glucanase

Position: -180
Score: 6
Sequence: GGGTGGGAGCGCTCCCATGT
Locus tag: SCAB_21081
Name: gunA
Funciton: Endoglucanase A (EC 3.2.1.4)
gunA
Endoglucanase A (EC 3.2.1.4)

Position: -133
Score: 6.7
Sequence: TCGTGGGAGCGCTCCCACAG
Locus tag: SCAB_57751
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SCAB_57741
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SCAB_57731
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE
Cellobiose specific ABC transporter, substrate-binding protein
cebF
Cellobiose specific ABC transporter, permease protein 1
cebG
Cellobiose specific ABC transporter, permease protein 2

Position: -63
Score: 6.1
Sequence: TCTTGGGAGCGCTCCCAATC
Locus tag: SCAB_90081
Name: celA1
Funciton: Endoglucanase (EC 3.2.1.4)
celA1
Endoglucanase (EC 3.2.1.4)

Position: -93
Score: 5.9
Sequence: AATTGGGAGCGCTCCCACTT
Locus tag: SCAB_8871
Name: cel1
Funciton: Secreted endoglucanase
cel1
Secreted endoglucanase

Position: -286
Score: 5.3
Sequence: TGGTGGAACCGCTCCCACTG
Position: -133
Score: 6.3
Sequence: ATATGGGAGCGCTCCCACTG
Locus tag: SCAB_17011
Name: cbhB
Funciton: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
Locus tag: SCAB_17021
Name: celA3
Funciton: Predicted endo-1,4-beta-glucanase
cbhB
1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
celA3
Predicted endo-1,4-beta-glucanase

Position: -251
Score: 4.7
Sequence: GTCGGGAACCGCTCCCACTG
Position: -108
Score: 6.5
Sequence: TCATGGGAGCGCTCCCACTG
Locus tag: SCAB_90091
Name: cbhB
Funciton: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
cbhB
1,4-beta-cellobiohydrolase B (EC 3.2.1.91)

Position: -131
Score: 5.1
Sequence: TACTGGAAGCGCTTCCAATG
Position: -116
Score: 6
Sequence: CAATGGGAGCGCTCCCACCT
Locus tag: SCAB_16431
Name: celA2
Funciton: Endoglucanase (EC 3.2.1.4)
celA2
Endoglucanase (EC 3.2.1.4)

Position: -314
Score: 6.3
Sequence: CAGTGGGAGCGCTCCCATAT
Position: -161
Score: 5.3
Sequence: CAGTGGGAGCGGTTCCACCA
Locus tag: SCAB_17001
Name: cbhA
Funciton: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
cbhA
1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD