Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type: Transcription factor
TF locus tag: SGR_4739
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose
Regulog: CelR - Streptomycetaceae
Statistics of regulated genes:
- Genes 11
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -334
Score: 6.2
Sequence: GTGTGGGAGCGCTCCCAGAT
Locus tag: SGR_199
Name: gunA
Funciton: Endoglucanase A (EC 3.2.1.4)
gunA
Endoglucanase A (EC 3.2.1.4)

Position: -124
Score: 6.3
Sequence: GCATGGGAGCGCTCCCACTC
Locus tag: SGR_4735
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SGR_4736
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SGR_4737
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE
Cellobiose specific ABC transporter, substrate-binding protein
cebF
Cellobiose specific ABC transporter, permease protein 1
cebG
Cellobiose specific ABC transporter, permease protein 2

Position: -55
Score: 5.5
Sequence: ATTTGAGAGCGCTCTCAAGG
Locus tag: SGR_3212
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SGR_3213
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SGR_3214
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: SGR_3215
Name: bglC2
Funciton: Beta-glucosidase (EC 3.2.1.21)
cebE
Cellobiose specific ABC transporter, substrate-binding protein
cebF
Cellobiose specific ABC transporter, permease protein 1
cebG
Cellobiose specific ABC transporter, permease protein 2
bglC2
Beta-glucosidase (EC 3.2.1.21)

Position: -18
Score: 5.7
Sequence: CCCAGGGAGCGCTCCCACAT
Locus tag: SGR_4738
Name: bglC2
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglC2
Beta-glucosidase (EC 3.2.1.21)

Position: -33
Score: 6.3
Sequence: GATTGGGAGCGCTCCCACAG
Locus tag: SGR_2445
Name: celA2
Funciton: Endoglucanase (EC 3.2.1.4)
celA2
Endoglucanase (EC 3.2.1.4)

Position: -109
Score: 6.2
Sequence: TCTTGGGAGCGCTCCCAATA
Locus tag: SGR_4739
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
celR
Cellobiose utilization transcriptional regulator CelR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD