Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO2794, SCO7554
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose
Regulog: CelR - Streptomycetaceae
Statistics of regulated genes:
- Genes 15
- Operons 12
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -16
Score: 5.9
Sequence: CTATGGGAGCGCTTCCATGC
Locus tag: SCO2798
Name: bglC2
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglC2
Beta-glucosidase (EC 3.2.1.21)

Position: -62
Score: 5.4
Sequence: CGCTGAGAGCGCTCTCAGAA
Locus tag: SCO7559
Name: SCO7559
Funciton: Putative sugar hydrolase
SCO7559
Putative sugar hydrolase

Position: -53
Score: 5.7
Sequence: GCGTGAGAGCGCTCTCAGGC
Locus tag: SCO0716
Name: SCO0716
Funciton: Putative glycosyl hydrolase
SCO0716
Putative glycosyl hydrolase

Position: -318
Score: 5.1
Sequence: CAGTGGGAGCGGTTCCATCA
Locus tag: SCO6548
Name: cbhA
Funciton: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
cbhA
1,4-beta-cellobiohydrolase A (EC 3.2.1.91)

Position: -74
Score: 6.3
Sequence: CCTTGGGAGCGCTCCCATGC
Locus tag: SCO0643
Name: SCO0643
Funciton: Putative secreted cellulose-binding protein
SCO0643
Putative secreted cellulose-binding protein

Position: -87
Score: 6
Sequence: AAGTGGGAGCGCTCCCATCA
Position: -61
Score: 5.3
Sequence: AGTTGGGAGCGCTCCCGCAC
Locus tag: SCO1187
Name: gunA2
Funciton: Endoglucanase A (EC 3.2.1.4)
gunA2
Endoglucanase A (EC 3.2.1.4)

Position: -85
Score: 5.7
Sequence: CTCTGAGAGCGCTCTCAGAA
Locus tag: SCO6665
Name: lamA1
Funciton: Predicted endo-1,3-beta-glucanase
lamA1
Predicted endo-1,3-beta-glucanase

Position: 29
Score: 6.2
Sequence: CTTTGGGAGCGCTCCCATCG
Locus tag: SCO7637
Name: SCO7637
Funciton: Secreted endoglucanase
SCO7637
Secreted endoglucanase

Position: -54
Score: 6
Sequence: ATTTGGGAGCGCTCCCATTC
Locus tag: SCO0765
Name: cel1
Funciton: Secreted endoglucanase
cel1
Secreted endoglucanase

Position: -221
Score: 5.1
Sequence: TGATGGAACCGCTCCCACTG
Position: -79
Score: 6.5
Sequence: CTATGGGAGCGCTCCCACTG
Locus tag: SCO6546
Name: cbhB
Funciton: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
Locus tag: SCO6545
Name: celA3
Funciton: Predicted endo-1,4-beta-glucanase
cbhB
1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
celA3
Predicted endo-1,4-beta-glucanase

Position: -147
Score: 6.6
Sequence: TTGTGGGAGCGCTCCCACAC
Locus tag: SCO2795
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SCO2796
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SCO2797
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE
Cellobiose specific ABC transporter, substrate-binding protein
cebF
Cellobiose specific ABC transporter, permease protein 1
cebG
Cellobiose specific ABC transporter, permease protein 2

Position: -238
Score: 6.6
Sequence: GTGTGGGAGCGCTCCCACAA
Locus tag: SCO2794
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
celR
Cellobiose utilization transcriptional regulator CelR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD